Prof_GD_Foster
Retired Prof in Molecular Plant Pathology: Emeritus in Everyway: enjoys life voraciously: enjoys beer: enjoys family & 2 dogs even more than beer(!) L'pool FC through thick & thin
- Reposted by Prof_GD_FosterResearchers have designed an electrode that allows for a month-long, noninvasive method of studying physiology and health in a diverse array of plants. Learn more in this week’s issue of #ScienceAdvances: scim.ag/4aay3yP
- Reposted by Prof_GD_FosterOur researchers reveal that light pollution disrupts nocturnal insects & spiders' movements.🏙️🕷️ Dr Rochelle Meah & Prof Nicholas Roberts highlight two key effects: 1️⃣ Masked day-to-night transitions. 🌙🕷️ 2️⃣ Blinded polarized light for navigation.☀️🦋 Read➡️: www.sciencedirect.com/science/arti...
- Reposted by Prof_GD_FosterLast chance to apply for our funded PhD opportunity. w. Prof. Fredric Coulon @ Cranfield University. This will investigate expansion of ML models for AMR phenotype detection to agriculture settings to create a sensor-ready hit list. Detail here: www.findaphd.com/phds/project...
- Reposted by Prof_GD_FosterUKRI pauses several funding calls amid priorities shake-up The applicant-led MRC funding calls on pause include research grants, partnership grants and new investigator research grants made available through the council’s research boards. www.researchprofessional.com/news-article...
- Reposted by Prof_GD_Fosterwww.findaphd.com/phds/project... interested in bacterial antagonism? PhD opportunity in our team, see below. Please repost!
- Needed hot sausage roll and hot drink as beach very windy and cold 🥶
- Before I retired, colleagues couldn’t believe that I’d just walk away easily. Saying I was so passionate about science and lecturing and my commitment to the university as a whole. You’ll get bored they said. Err…..no 😂 Best life after 🙃
- Available to a good home: A beer belly...I've been looking after it over Xmas as I can't locate it's owner. It's not damaged..... It follows me everywhere and is very cuddly.
- I turned my mine down again. The just won’t leave me be. news.sky.com/story/new-ye...
- Something for the nerds out there.... CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGGACGTGGGAAGAACCCTCG
- Been a while since I published children’s books. But now that our wee man is 22 months & LOVES books, how could Granny & Gramps not write a new one. Now available in all good book shops and all online sites Dylan and the Dinosaur 🦖 amzn.eu/d/2vyxxt2
- Publish or Perish: A Humorous Party Game about Academic Publishing The Publish or Perish Game is a humorous party game about academic publishing. Players race to publish manuscripts with useless nonsense while sabotaging each other's research!!!!! publishorperish.games?utm_medium=p...
- One man (little old me) and his dog.
- Building capacity in vector-borne plant virus research: The CONNECTED Network nph.onlinelibrary.wiley.com/doi/10.1002/...
- Oh how us virologists ranted and raved. But no one listened. ‘Too little, too late’: damning report condemns UK’s Covid response
- Reposted by Prof_GD_FosterNEW from me: Political hostility, high visa fees and (in the case of the UK) stagnant incomes are making the UK and US less attractive destinations for top international talent. That steep decline in the appeal of moving to the US after 2016 is 👀
- Back in gods homeland the great wee Norn Iron. The wind is howling, the wind is horizontal, yep we are deffo home.
- My view as a virologist over 2 years before COVID hit !!
- Very appropriate 😂😂😂 My better half would agree 🙃
- Our kids never threw out a book their entire lives. Therefore we’ve about 25 years worth stored in our loft for both of them. We’ve finally decided to sort Finding some classics. Fishing with Foster….The legend begins 😂 could change ‘fishing’ for a wide range of things 😂😂😂
- Deffo me towards the end….. 😂
- Only UK people will understand and also those of a certain age. Still very very proud of all my badges especially the silver. Still have all my letters from Biddy Baxter. The nicest person I’ve ever met in my childhood universe. #BluePeter
- UK universities have collectively announced more than 12,000 job cuts in the last year www.bbc.co.uk/news/article...
- Thousands more UK university jobs cut as financial crisis deepens www.bbc.co.uk/news/article...
- UK universities offered to monitor students’ social media for arms firms, emails show www.theguardian.com/education/20...
- As an academic/scientist I might’ve worked on sweet potato diseases for many years. But I’ve still got a lot to learn about growing them outside in the UK. But still not to bad a crop so far 🍠
- Glasgow University accused of failing student who killed himself on graduation day Ethan Scott Brown was wrongly told he had not earned geography degree despite marks being enough for a 2:1 www.theguardian.com/education/20...
- 🌽 🥔 🍅 🫛 🌾 🍎 www.cnn.com/2025/09/16/u...
- Needed a drink to get thru Dancing Queen and Super Trouper
- Our daughter bought us tickets to see the ABBA Show in London. We are in a restaurant close by and realised Friday night is regarded as ‘Ladies Night’. I’m lsurrounded by 100s of menopausal women in glitter & sparkles. I think I’m gonna be vastly outnumbered in the arena. Please pray for me 🙏
- Reposted by Prof_GD_Foster[Not loaded yet]
- HBD 🥳 to my very own Queen of the Slipstream ❤️
- ICTV have decided not to use Latin anymore. They’ve now decided to use Ancient Elvish for naming.
- An abomination. Latin names are idiotic for viruses.

- 👇👇👇👇👇👇👇

- We lost deliberately. Mo is a genius as he knew no team in history has won the Community Shield and then gone on to win the league that season.
- Not bloody penalties. I’m on holiday. It’s too early in the season to get this stressed. ⚽️
- Front row seats in pub in Croyde for Liverpool match ⚽️ Pint of lovely chilled cider and chilli nachos. #heaven
- 👇👇👇👇👇👇👇👇👇👇
- VACANCY - We’re recruiting for a visionary group leader to lead fundamental research on Discovery Plant Science as part of our vibrant research community Successful candidate will be offered a six-year tenure-track position with the opportunity to apply for tenure: www.jic.ac.uk/vacancies/gr...

- Front row seats in pub in Croyde for Liverpool match ⚽️ Pint of lovely chilled cider and chilli nachos. #heaven
- Reposted by Prof_GD_Foster[Not loaded yet]
- Reposted by Prof_GD_FosterToday, our article "The entities enabling scientific fraud at scale are large, resilient, and growing rapidly" is finally published in PNAS. I hope that it proves to be a wake-up-call for the whole scientific community. reeserichardson.blog/2025/08/04/a...
- Could RFK Jr's move to pull mRNA vaccine funding be a huge miscalculation? YES !!!!! www.bbc.com/news/article...
- Tonight’s menu. Just a little something I rattled up the good lady. But she’s worth it.
- Edinburgh University’s ‘skull room’ highlights its complicated history with racist science Skulls were collected from all over the world because of some academics’ fascination with phrenology, the discredited belief that skull shape denoted intelligence www.theguardian.com/education/20...
- Excellent thought provoking article on what is a difficult subject. Universities are 'failing us' on mental health, say students - but should it really be up to them? www.bbc.co.uk/news/article...